Virulence plasmids in salmonella
Current address: Department of Microbiology, Biomedical Research Institute, University Hospital, A Coruña, Spain
Affiliation Department of Functional Biology, Area of Microbiology, University of Oviedo, Oviedo, Asturias, Spain
Affiliation Antimicrobial Resistance and Healthcare Associated Infections Reference Unit, Public Health England (PHE), London, United Kingdom
Affiliation Department of Functional Biology, Area of Microbiology, University of Oviedo, Oviedo, Asturias, Spain
Affiliation Department of Biological Safety, Federal Institute for Risk Assessment (BfR), Berlin, Germany
Affiliation Department of Functional Biology, Area of Microbiology, University of Oviedo, Oviedo, Asturias, Spain
Affiliation Antimicrobial Resistance and Healthcare Associated Infections Reference Unit, Public Health England (PHE), London, United Kingdom
Affiliation Department of Bacteriology and TSEs, Central Veterinary Institute (CVI), Lelystad, The Netherlands
Affiliation Department of Biological Safety, Federal Institute for Risk Assessment (BfR), Berlin, Germany
Affiliation Department of Functional Biology, Area of Microbiology, University of Oviedo, Oviedo, Asturias, Spain
Affiliation Department of Biological Safety, Federal Institute for Risk Assessment (BfR), Berlin, Germany
¶ Membership of the Med-Vet-Net WP21 Project Group is provided in the Acknowledgments.
- Patricia García,
- Katie L. Hopkins,
- Vanesa García,
- Janine Beutlich,
- M. Carmen Mendoza,
- John Threlfall,
- Dik Mevius,
- Reiner Helmuth,
- M. Rosario Rodicio,
- Beatriz Guerra
Figures
Abstract
Plasmids encoding resistance and virulence properties in multidrug resistant (MDR) Salmonella enterica (S.) serovar Typhimurium monophasic variant 4,[5],12:i:- isolates recovered from pigs and humans (2006-2008) in Europe were characterised. The isolates were selected based on the detection by PCR-amplification of S. Typhimurium virulence plasmid pSLT genes and were analysed by multi-locus sequence typing (MLST). The resistance genes present in the isolates and the association of these genes with integrons, transposons and insertion sequences were characterised by PCR-sequencing, and their plasmid location was determined by alkaline lysis and by S1-nuclease pulsed-field gel electrophoresis (PFGE) Southern-blot hybridisation. Plasmids were further analysed by replicon typing, plasmid MLST and conjugation experiments. The 10 S. 4,[5],12,i:- selected isolates belonged to ST19. Each isolate carried a large plasmid in which MDR with pSLT-associated virulence genes were located. After analysis, eight different plasmids of three incompatibility groups (IncA/C, IncR and IncF) were detected. Two IncA/C plasmids represented novel variants within the plasmid family of the S. 4,[5],12:i:- Spanish clone, and carried an empty class 1 integron with a conventional qacEΔ1-sul1 3′ conserved segment or an In-sul3 type III with estX-psp-aadA2-cmlA1-aadA1-qacH variable region linked to tnpA440-sul3, part of Tn2, Tn21 and Tn1721 transposons, and ISCR2. Four newly described IncR plasmids contained the resistance genes within In-sul3 type I (dfrA12-orfF-aadA2-cmlA1-aadA1-qacH/tnpA440-sul3) and part of Tn10 [tet(B)]. Two pSLT-derivatives with FIIs-ST1+FIB-ST17 replicons carried cmlA1-[aadA1-aadA2]-sul3-dfrA12 and blaTEM-1 genes linked to an In-sul3 type I integron and to Tn2, respectively. In conclusion, three emerging European clones of S. 4,[5],12:i:- harboured MDR plasmids encoding additional virulence functions that could contribute significantly to their evolutionary success.
Editor: Dipshikha Chakravortty, Indian Institute of Science, India
Funding: This work was supported by the EU Network of Excellence Med-Vet-Net (WP 21), the “Fondo de Investigación Sanitaria” of the “Instituto de Salud Carlos III” (FIS PI11-00808, Spain), co-funded by European Regional Development Fund of the European Union: a way to making Europe, and the Federal Institute for Risk Assessment (BfR: 46-001, 45-004, Germany). PG was the recipient of a grant from the “Fundación para el Fomento en Asturias de la Investigación Científica Aplicada y la Tecnología” (FICYT, Ref. BP08-031). She performed a short stay at the Department of Biological Safety of the Federal Institute for Risk Assessment (BfR), Berlin, Germany, supported by the same grant. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The emergence of multiple clones of Salmonella enterica (S.) serovar Typhimurium-like strains lacking expression of the second flagellar antigen (S. 4,[5],12:i:- throughout the manuscript) has been reported worldwide [1]. Since the mid-1990s in Europe, S. 4,[5],12:i:- isolates have been increasingly implicated in human disease, and pig and pork products play an important role as a source of infection [1], [2]. Given the increase in their prevalence, these isolates represent a public health hazard and have been included in the European Salmonella control systems (http://eur-lex.europa.eu Accessed 1 January 2014). In addition, the two major clones circulating in Europe (labelled as Spanish and European clones) show multidrug resistance (MDR) to four or more unrelated classes of antimicrobials, making continued surveillance of their emergence and spread particularly important. Isolates belonging to the European clone exhibit resistance to ampicillin, streptomycin, sulphonamides and tetracycline (tetraR-type AMP-STR-SUL-TET) due to the presence of a resistance region on the bacterial chromosome, and lack the typical S. Typhimurium virulence plasmid (94 kb, pSLT) [1]–[4]. In contrast, the isolates belonging to the Spanish clone show a MDR phenotype with additional resistance to chloramphenicol, gentamicin and trimethoprim (AMP-CHL-GEN-STR/SPE-SUL-TET-TMP or variants therein) mediated by large non-conjugative plasmids (IncA/C or IncA/C+IncN plasmids of the pUO-STmRV1-like group) carrying the spv locus of the Salmonella virulence plasmids [1], [5], [6]. In order to investigate the presence and diversity of plasmids encoding resistance and virulence properties, which could give a selective advantage to emerging clones of S. 4,[5],12:i:- in Europe, isolates collected from different sources and countries within the European Union Network of Excellence (NoE) Med-Vet-Net were analysed.
Materials and Methods
The isolates included in this work belong to the S. 4,[5],12:i:- European NoE Med-Vet-Net (www.medvetnet.org) WP21 collection. This collection [4], included 116 Salmonella monophasic isolates recovered from human, pig and pork products (2006–2008) provided by eight participating laboratories from six countries (Public Health England, and the Animal Health and Veterinary Laboratories Agency, UK; the Agence Française de Sécurité Sanitaire des Aliments, France, the Federal Institute for Risk Assessment, Germany, the Istituto Superiore di Sanità, Italy; the National Institute of Public Health in Warsaw, Poland; the Health Surveillance Centre (VISAVET), University Complutense in Madrid, Spain and the Central Veterinary Institute of Wageningen, the Netherlands). Data on features like phage type, antimicrobial resistance pattern, XbaI-PFGE pattern and multiple-locus variable-number tandem repeat analysis (MLVA) profile of the isolates, were previously published [4]. Since the aim of the present study was the detection and further characterization of plasmids containing resistance and virulence genes, we followed two criteria for selection within this collection: MDR phenotype different than the tetraR-type of the European clone (characteristically lacking the virulence pSLT plasmid) together with the detection of the spvC gene (gene widely used as a molecular marker for the detection of pSLT or pSLT-derivatives [7]). Only spvC-positive isolates (10 isolates) were suspected to contain a hybrid plasmid and were further analyzed. Multilocus sequence typing (MLST) was performed in the present study according to the website database recommendations (http://mlst.ucc.ie/mlst/dbs/Senterica).
The isolates were tested by broth microdilution for their antimicrobial susceptibility against a panel of 14 antimicrobials (ampicillin, cefotaxime, ceftazidime, chloramphenicol, ciprofloxacin, colistin, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, sulfamethoxazole, tetracycline, and trimethoprim) as previously described [8]. The results were analysed following the cut-offs set by EUCAST (www.eucast.org). Genes responsible for resistance to ampicillin [blaPSE-1, blaOXA-1-like, blaTEM-1-like], chloramphenicol [catA1, cmlA1, floR], aminoglycosides [aac(3)-IV, aadA1-like, aadA2, strA, strB], sulphonamides [sul1, sul2, sul3], tetracycline [tet(A), tet(B)] and trimethoprim [dfrA1-like, dfrA12] were studied by multiplex and simplex PCR-amplification [8]. The genetic environments were characterized by overlapping PCR-amplification and sequencing (Table S2 and Figure S1).
The horizontal transmission capabilities of the plasmids were investigated by conjugation experiments. For this analysis six strains (two per VR- or RV- plasmid incompatibility group detected) were chosen. These strains carried the following plasmids: pMVN-STmRV1 and pMVN-STmRV2 of IncA/C (160 kb); pMVN-STmRV3 (100 kb) and pMVN-STmRV6 (160 kb) of IncR and pMVN-STmVR1 (130 kb) and pMVN-STmVR2 (160 kb) of IncF. Mating assays were performed in liquid broth (30°C and 37°C) for 20 h, using S. 4,[5],12:i:- strains as donors and rifampicin-resistant E. coli K-12 J53 as recipient. Transconjugants were selected on Eosin-Methylene Blue agar plates containing rifampicin (50 mg/L) plus either chloramphenicol (30 mg/L), sulphonamides (300 mg/L), tetracycline (30 mg/L) and/or trimethoprim (10 mg/L).
Abstract
The spv operon is common to all Salmonella virulence plasmids. DNA hybridization analysis indicates that the spv region is limited in distribution to serovars of Salmonella enterica subspecies I, II, IIIa, IV, and VII and is absent from Salmonella bongori isolates. Among strains of subspecies II, IIIa, and VII, all isolates examined contained sequences that hybridized with the spv region. However, among isolates of subspecies I, DNA sequences capable of hybridizing with the spv region were found in some isolates of certain serovars. Furthermore, in isolates of subspecies I, the virulence plasmid was found in the same set of isolates as an F-related plasmid, as determined by the presence of the spv region of the virulence plasmid and the finO, traD, and repA sequences of the F-plasmid. The concordance of the virulence plasmid and all three F-plasmid sequences in subspecies I serovar Choleraesuis, Paratyphi, and Typhimurium is most easily explained if the spv region is carried in an F-related plasmid in these isolates. In contrast, among S. enterica subspecies II, IIIa, IV, and VII, the isolates that contain spv sequences did not hybridize with an F-related plasmid or any other identifiable plasmid. With the use of pulse-field gel electrophoresis, the spv region in subspecies II, IIIa, and VII was found to be encoded on the chromosome. Analysis of the phylogenetic distribution of spv among Salmonella isolates and comparative nucleotide sequence analysis of spvA and spvC suggests that the spv region was acquired very recently, after speciation of the salmonellae.
SALMONELLA has been implicated in a wide variety of infections ranging from life-threatening typhoid to gastroenteritis and bacteremia. Salmonella is a facultative intracellular pathogen, typically colonizing reptiles, birds, and mammals, with some serovars showing remarkable host-adaptation; for example, serovars Typhi, Dublin, and Gallinarum infect humans, cattle, and birds, respectively, although by no means are these serovars restricted to these hosts (F alkow 1996). In view of the diversity of animal species infected and the complex mechanisms of infection, it is not surprising that the array of genes required for virulence depends on the particular host and the mode of infection.
In regard to Salmonella enterica subspecies I, the virulence properties of various serovars, Typhimurium, Choleraesuis, Dublin, and Enteriditis, depend on the presence of large plasmids 65–100 kb in size to cause systemic infection (J ones et al. 1982; T erakado et al. 1983; N akamura et al. 1985; G ulig and C urtiss 1987). Analysis has shown that the virulence plasmids from different serovars share a related 7.8-kb virulence region, the spv gene cluster, which includes five open reading frames designated spvR, spvA, spvB, spvC, and spvD (B aird et al. 1985; W illiamson et al. 1988; N orel et al. 1989; T aira and R hen 1989; K rause et al. 1991; G ulig et al. 1993). The spvR gene encodes a regulatory protein of the LysR family that, together with the chromosomally encoded regulatory gene rpoS, regulates the spvABCD genes (T aira et al. 1991; F ang et al. 1992; N orel et al. 1992; G ulig et al. 1993). The function of the spvABCD gene products remains undetermined, but it has been shown that the presence of the virulence plasmid increases the growth rate of Salmonella in mice (G ulig and D oyle 1993).
The spv region of the Salmonella virulence plasmid represents only a small proportion of the plasmid-coding capability, and little is known about the coding capacity of the rest of the virulence plasmid. Tinge and Curtiss (1990) demonstrated that the virulence plasmid of serovar Typhimurium contained three replication (rep) regions repA (par), repB, and repC. The repB and repC regions hybridize weakly with IncFI plasmid F and IncFII plasmid R100, respectively; however, neither repB or repC conferred incompatibility with F or R100. The rck and traT genes also present in the serovar Typhimurium virulence plasmid encode outer membrane proteins whose expression confers survival in macrophages (H effernan et al. 1992; R hen et al. 1992). Recently, it has also been demonstrated that the virulence plasmid of Typhimurium encodes a fimbrial biosynthesis operon, pef (F riedrich et al. 1993). Examination of the virulence plasmid of Salmonella serovars Gallinarum, Enteritidis, and Typhimurium demonstrated the presence of F-like OriT, but this region was not found in the virulence plasmid of serovars Choleraesuis and Dublin (O u et al. 1994). Further, DNA hybridization ofthe nonvirulence coding part of the virulence plasmid of serovar Dublin with Escherichia coli and Salmonella spv-negative plasmids indicates a common origin of this region of the plasmid (A abo et al. 1995). Similarly, the large virulence plasmid of Shigella flexneri showed homology with part of the transfer region of F and with vagC and vagD of the Salmonella serovar Dublin virulence plasmid (R adnedge et al. 1997). Rodriguez-Pena and colleagues (1997) have recently shown the virulence plasmid from serovar Enteriditis could have arisen from the Typhimurium plasmid through deletions, and both plasmids share homology in the tra region from IncFII plasmids.
The genus Salmonella proper is divided into two species: S. bongori (formerly S. enterica subspecies V; R eeves et al. 1989) and S. enterica. The species S. enterica is further subdivided into seven subspecies, designated by the roman numerals I, II, IIIa, IIIb, IV, VI, and VII (L e M inor and P opoff 1987; S elander et al. 1994; B oyd et al. 1996). The majority of Salmonella human pathogens belong to subspecies I isolates, whereas subspecies IIIa, IIIb, II, IV, and VII and S. bongori are mainly associated with cold blooded vertebrates (P opoff and L e M inor 1992).
The true prevalence of the virulence plasmid among natural isolates of Salmonella is unknown. Previous studies have shown the occurrence of the virulence plasmid among a few serovars of S. enterica subspecies I, to which 99% of the medically important serovars belong (W illiamson et al. 1988; B äumler et al. 1997). Herein, we find that among the salmonellae, the spv region is found in all isolates of S. enterica subspecies II, IIIa, and VII isolates. Of the 72 subspecies I isolates examined of the Salmonella reference collection B (SARB), 15 strains showed homology with the spv probe, and further analysis showed these 15 isolates also hybridized with the F plasmid probes, finO, traD, and repA. Analysis of nucleotide and amino acid substitutions of the spvA gene suggests there has been rapid divergence, possibly related to niche specialization, among the subspecies. From the standpoint of population genetics, the most important result is that the presence of the Salmonella virulence plasmid is highly correlated with the presence of an F-related plasmid. Further, the finding of the presence of the spv region on the chromosome of subspecies II, IIIa, IV, and VII isolates is also significant. From the microbial pathogenesis perspective, the probability that the spv region is part of an F-related plasmid in isolates of subspecies I is significant in relation to the potential for frequent horizontal transmission among strains and species.
MATERIALS AND METHODS
Bacterial strains: We examined 72 isolates of the SARB collection, which includes 37 medically important serovars of subspecies I of S. enterica whose phylogenetic relationships are known (B oyd et al. 1993). In addition, we examined 80 natural isolates of the Salmonella reference collection C (SARC; B oyd et al. 1996), which represents most of the genetic diversity within the genus. SARC is composed of S. bongori (11 isolates) and all 7 subspecies of S. enterica: I (11 isolates), II (14 isolates), IIIa (4 isolates), IIIb (4 isolates), IV (9 isolates), VI (20 isolates), VII (4 isolates). Total genomic DNA was extracted with the G-Nome DNA isolation kit (Bio 101, La Jolla, CA).
PCR amplification: Primers for PCR and DNA sequencing were designed from published sequence of the spv virulence region (K rause et al. 1990). PCR products were purified using the Qiaquick PCR purification kit (Quigen Inc., La Jolla, CA).
DNA hybridization: Plasmid DNA was isolated from Salmonella strains. All isolates were examined by restriction digests with EcoRI and electrophoresed in 0.6% agarose gels and transferred to Hybond N + membranes. DNA fragments for use as fluoresin probes in Southern hybridizations were prepared from S. enterica serovar Typhimurium LT2. Three DNA probes were constructed, which encompassed the entire spv region. The spv fragments were amplified by long-range PCR and labeled to high-specify activity by the random-labeling method [enhanced chemilumence (ECL); Amersham, Arlington Heights, IL]. The F-plasmid probes were prepared as previously described (B oyd and H artl 1997). Prehybridizations were performed in 10× SSC, 0.2% SDS, 10% dextran sulfate, and 5% ECL liquid block for 1 hr. Hybridization of probes was carried out overnight at 60° (55° for reduced stringency). Membrane washes were at 60° (55° for reduced stringency) in 1× SCC and 0.1% SDS. Hybridized fragments were detected with the ECL system.
Association of genes with plasmids: To determine whether the genes examined were plasmid encoded, total genomic DNA was separated on 0.6% agarose for an extended time to permit separation of plasmid DNA from the bacterial chromosomal band. DNA was transferred to Hybond N + membranes and DNA was cross-linked by ultraviolet exposure. Membranes were hybridized with plasmid probes overnight under both high (60°) and low (55°) stringency conditions.
Pulsed field gel electrophoresis (PFGE): To determine whether the spv region in isolates outside of subspecies I are encoded on the chromosome, PFGE was carried out. Agarose plugs were prepared as previously described (B ergthorsson and O chman 1995). Agarose plugs were washed five times for 5 min each in 50 vol distilled H2O and equilibrated in the appropriate restriction buffer. Agarose plugs were digested with I-CeuI (NEB) as described by B ergthorsson and O chman (1998). The restriction enzyme I-CeuI cuts at rDNA operons only. Electrophoresis was performed with a CHEF-DR II apparatus (Bio-Rad Laboratories, Richmond, CA). Electrophoresis was carried out as previously described (B ergthorsson and O chman 1998). DNA was transferred to a nylon membrane, and an spv DNA probe was used to detect homology.
Nucleotide sequencing: Two genes from the spvABCD operon were sequenced from representative isolates of Salmonella. DNA sequencing of PCR-amplified DNA was performed with a 370A DNA sequencer following manufacturers' instructions. Both dyeterminator and dyeprimer chemistries were used. All sequences have been deposited in GenBank accession numbers AF051816-AF051829.
Phylogenetic and statistical analysis: DNA sequence data were assembled and edited with sequencer programs (1991). Phylogenetic analysis was performed with the programs Molecular Evolutionary Genetic Analysis, version 1.0 (K umar et al. 1993) and Molecular Evolutionary Analysis (E tsuko M oriyama , Yale University).
Genotypic characterization of spv-positive SARB strains and their hybridization with F-plasmid sequences
Article Figures & Data
Characteristics of the primers used in this study
| Name | Gene region a | Strand | Nucleotide sequence | Source or reference |
|---|---|---|---|---|
| Par1 | parBS | + | ggcgtcaatggttgagatgact | 3 |
| Par2 | parBS | − | gtccagttcatcctgaaccact | 3 |
| IncR1 | incR,parA | + | agcacgtttgacagggtaacg | 3 |
| IncR2 | incR,parA | − | gtggcgactttccgtaactgct | 3 |
| SpvR | spvRA | + | aacaccatgattagtaagaactaatcagt | 15 |
| SpvA | spvRA | − | cctgaacaatgacgtcgctcagat | 15 |
| SpvC1 | spvC | + | cttgcacaaccaaatgcggaagat | 15 |
| SpvC2 | spvC | − | ctctgcatttcaccaccatcacg | 15 |
| Rsk1 | rsk | + | ccctacccaggtgttgaagtcat | 30 |
| Rsk2 | rsk | − | ccttctccctctcagcagcttcat | 30 |
| RepA1 | repA(RepFIB) | − | gaaccggcaaggaagcgcaatgt | 25 |
| RepA2 | repA(RepFIB) | + | ccctacccaggtcttgaaatcgt | 25 |
| PefA | pefAC | + | ccgaaggtgacttcaagtctgt | 6 |
| PefC | pefAC | − | cggcatttgcataggcactggt | 6 |
| PefD1 | pefD,orf5 | + | gcagcagtacggtgtatatggt | 6 |
| PefD2 | pefD,orf5 | − | cctccggtgaattttgccggaat | 6 |
| Rck1 | rck | + | tcgttctgtcctcactgctgct | 9 |
| Rck2 | rck | − | accggtaaccgacaccaacgtt | 9 |
| RepB1 | repA(RepFIIA) | + | ccctgccgttctgtcgtaagct | 25 |
| RepB2 | repA(RepFIIA) | − | tggtaggtaatcagccccagct | 25 |
| TraX-1 | traX, finO | + | aaccgtggcgctgctgctgat | This study |
| TraX-F | traX, finO | − | cttccacttcgggggcgtggt | This study |
| TraT-1 | traT | + | ggttacactggtcagttccactct | 24 |
| TraT-2 | traT | − | gccagttgttcttccagaactggt | 24 |
| Spt5 | oriT | + | ggttacgggattccttccatgaaat | This study |
| TraM-F2 | oriT | − | atatctttatctctcgccccttcct | This study |
| Sam1 | samA | + | gaggaactggatctgaatgcct | 20 |
| Sam2 | samA | − | gatttcctccaccggttgcagt | 20 |
Genes detected by PCR and DNA-DNA hybridization
| Gene | Result for virulence plasmid a : | |||
|---|---|---|---|---|
| pSTV | pSEV | pSCV | pSDV | |
| parBS | + | + | + | + |
| incR, parA | + | + | + | + |
| spvRA | + | + | + | + |
| spvC | + | + | + | + |
| rsk | + | + | + | − |
| repA(RepFIB) | + | + | + | − |
| pefAC | + | + | + | −/+ |
| pefD, orf5 | + | + | −/+ | − |
| rck | + | + | − | + |
| repA(RepFIIA) | + | + | + | + |
| traX, finO | + | − | + | + |
| traT | + | − | + | + |
| oriT | + | + | − | − |
| samA | + | + | + | + |
↵ a +, positive reaction; −, negative reaction; −/+, PCR negative and Southern blot positive.
Читайте также:
